STAM-signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 Gene View larger

STAM-signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STAM-signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about STAM-signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030586
Product type: DNA & cDNA
Ncbi symbol: STAM
Origin species: Human
Product name: STAM-signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 Gene
Size: 2ug
Accessions: BC030586
Gene id: 8027
Gene description: signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Synonyms: STAM-1; STAM1; signal transducing adapter molecule 1; HSE1 homolog; signal transducing adaptor molecule (SH3 domain and ITAM motif) 1; signal transducing adaptor molecule
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctctttttgccaccaatcccttcgatcaggatgttgagaaagcaaccagcgagatgaatactgctgaggactggggcctcattttggatatctgtgataaagttggtcagtctcgcactggacctaaggattgtcttcggtctattatgagaagagtgaaccacaaagatcctcacgttgctatgcaggctttgactcttctaggagcatgtgtatcaaactgtggcaaaatttttcatttagaagtatgttcaagagattttgctagtgaagtaagcaacgtattaaataagggtcatcctaaagtatgtgaaaaattaaaggctcttatggttgaatggacagatgaatttaagaatgatccacagcttagtctaatatcagcaatgattaagaaccttaaggaacaaggagttacgttcccagctattggctctcaggctgcagaacaagcaaaagcaagcccagctcttgtagccaaggatcctggtactgtggctaacaaaaaagaagaagaagatttagcaaaagccattgagttgtctctcaaggaacaaaggcagcagtcaaccaccctttccactttgtatccaagcacatccagtctcttaactaaccaccaacatgaaggccgaaaagttcgtgctatatatgactttgaagctgctgaagacaatgaacttacttttaaagctggagaaattattacagttcttgatgacagtgatcctaactggtggaaaggtgaaacccatcaaggcatagggttatttccttctaattttgtgactgcatatctcactgctgaaccagaaatgattaaaacagagaagaagacggtacaatttagtgatgatgttcaggtagagacaatagaaccagagccggaaccagcctttattgatgaagataaaatggaccagttgctacagatgctgcaaagtacagaccccagtgatgatcagccagacctaccagagctgcttcatcttgaagcaatgtgtcaccagatgggacctctcattgatgaaaagctggaagatattgatagaaaacattcagaactctcagaacttaatgtgaaagtgatggaggccctttccttatataccaagttaatgaacgaagatccgatgtattccatgtatgcaaagttacagaatcagccaggcagtggtcccaccatccgcaaacccagcccttcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine rich repeat and fibronectin type III domain containing 4
- eukaryotic translation initiation factor 4E binding protein 2
- spermatogenesis and oogenesis specific basic helix-loop-helix 2
- UTP23, small subunit (SSU) processome component, homolog (yeast)

Buy STAM-signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 Gene now

Add to cart