Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
STAM-signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 Gene
PTXBC030586
New product
Data sheet of STAM-signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about STAM-signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030586 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | STAM |
| Origin species: | Human |
| Product name: | STAM-signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 Gene |
| Size: | 2ug |
| Accessions: | BC030586 |
| Gene id: | 8027 |
| Gene description: | signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 |
| Synonyms: | STAM-1; STAM1; signal transducing adapter molecule 1; HSE1 homolog; signal transducing adaptor molecule (SH3 domain and ITAM motif) 1; signal transducing adaptor molecule |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctctttttgccaccaatcccttcgatcaggatgttgagaaagcaaccagcgagatgaatactgctgaggactggggcctcattttggatatctgtgataaagttggtcagtctcgcactggacctaaggattgtcttcggtctattatgagaagagtgaaccacaaagatcctcacgttgctatgcaggctttgactcttctaggagcatgtgtatcaaactgtggcaaaatttttcatttagaagtatgttcaagagattttgctagtgaagtaagcaacgtattaaataagggtcatcctaaagtatgtgaaaaattaaaggctcttatggttgaatggacagatgaatttaagaatgatccacagcttagtctaatatcagcaatgattaagaaccttaaggaacaaggagttacgttcccagctattggctctcaggctgcagaacaagcaaaagcaagcccagctcttgtagccaaggatcctggtactgtggctaacaaaaaagaagaagaagatttagcaaaagccattgagttgtctctcaaggaacaaaggcagcagtcaaccaccctttccactttgtatccaagcacatccagtctcttaactaaccaccaacatgaaggccgaaaagttcgtgctatatatgactttgaagctgctgaagacaatgaacttacttttaaagctggagaaattattacagttcttgatgacagtgatcctaactggtggaaaggtgaaacccatcaaggcatagggttatttccttctaattttgtgactgcatatctcactgctgaaccagaaatgattaaaacagagaagaagacggtacaatttagtgatgatgttcaggtagagacaatagaaccagagccggaaccagcctttattgatgaagataaaatggaccagttgctacagatgctgcaaagtacagaccccagtgatgatcagccagacctaccagagctgcttcatcttgaagcaatgtgtcaccagatgggacctctcattgatgaaaagctggaagatattgatagaaaacattcagaactctcagaacttaatgtgaaagtgatggaggccctttccttatataccaagttaatgaacgaagatccgatgtattccatgtatgcaaagttacagaatcagccaggcagtggtcccaccatccgcaaacccagcccttcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine rich repeat and fibronectin type III domain containing 4 - eukaryotic translation initiation factor 4E binding protein 2 - spermatogenesis and oogenesis specific basic helix-loop-helix 2 - UTP23, small subunit (SSU) processome component, homolog (yeast) |