RIC3-resistance to inhibitors of cholinesterase 3 homolog (C. elegans) Gene View larger

RIC3-resistance to inhibitors of cholinesterase 3 homolog (C. elegans) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RIC3-resistance to inhibitors of cholinesterase 3 homolog (C. elegans) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RIC3-resistance to inhibitors of cholinesterase 3 homolog (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022455
Product type: DNA & cDNA
Ncbi symbol: RIC3
Origin species: Human
Product name: RIC3-resistance to inhibitors of cholinesterase 3 homolog (C. elegans) Gene
Size: 2ug
Accessions: BC022455
Gene id: 79608
Gene description: resistance to inhibitors of cholinesterase 3 homolog (C. elegans)
Synonyms: RIC3 acetylcholine receptor chaperone; AYST720; PRO1385; protein RIC-3; resistance to inhibitors of cholinesterase 3-like protein; resistant to inhibitor of cholinesterase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtactccacagtgcagagagtcgctctggcttctgggcttgtcctggctctgtcgctgctgctgcccaaggccttcctgtcccgcgggaagcggcaggagccgccgccgacacctgaaggaaaattgggccgatttccacctatgatgcatcatcaccaggcacactcagatggccagactcctggggctcgtttccagaggtctcaccttgccgaggcatttgcaaaggccaaaggatcaggtggaggtgctggaggaggaggtagtggaagaggtctgatggggcagattattccgatctacggttttgggatttttttatatatactgtacattctatttaagctctcaaaggggaaaacaactgcagaggatgggaaatgctatactgccatgcctggaaacacccacaggaaaattaccagttttgagcttgctcaactgcaagaaaaactgaaggagacagaagcagccatggaaaaattattcaacagagtgggacctaatggtgagagagcacagactgtgacttctgaccaagagaaacggttgctacatcagctccgagaaatcaccagggtcatgaaagaaggaaaattcattgacagattttctccagagaaagaagctgaggaggccccttacatggaggactgggaaggttaccctgaagagacttacccaatttatgacctttcagactgtatcaagcgtaggcaagaaacaatcttggtggattaccctgacccaaaagaactttctgctgaagaaatagctgaaagaatgggaatgatagaagaggaagaatcagatcatttgggttgggaaagtctgcccactgaccccagagcccaggaagataattctgttacctcgtgtgatccaaagccagaaacatgttcctgctgttttcatgaagacgaggatcctgctgtcttggcagagaatgctggattcagtgcagatagctaccctgagcaagaggaaaccaccaaagaagagtggtcccaagactttaaagatgaagggttgggcatcagcacagataaagcatatacaggcagcatgctgaggaagcgtaacccccagggtttagagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
- leucine rich repeat and fibronectin type III domain containing 4
- eukaryotic translation initiation factor 4E binding protein 2
- spermatogenesis and oogenesis specific basic helix-loop-helix 2

Buy RIC3-resistance to inhibitors of cholinesterase 3 homolog (C. elegans) Gene now

Add to cart