No products
Prices are tax excluded
PTXBC022455
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022455 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RIC3 |
| Origin species: | Human |
| Product name: | RIC3-resistance to inhibitors of cholinesterase 3 homolog (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC022455 |
| Gene id: | 79608 |
| Gene description: | resistance to inhibitors of cholinesterase 3 homolog (C. elegans) |
| Synonyms: | RIC3 acetylcholine receptor chaperone; AYST720; PRO1385; protein RIC-3; resistance to inhibitors of cholinesterase 3-like protein; resistant to inhibitor of cholinesterase 3 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtactccacagtgcagagagtcgctctggcttctgggcttgtcctggctctgtcgctgctgctgcccaaggccttcctgtcccgcgggaagcggcaggagccgccgccgacacctgaaggaaaattgggccgatttccacctatgatgcatcatcaccaggcacactcagatggccagactcctggggctcgtttccagaggtctcaccttgccgaggcatttgcaaaggccaaaggatcaggtggaggtgctggaggaggaggtagtggaagaggtctgatggggcagattattccgatctacggttttgggatttttttatatatactgtacattctatttaagctctcaaaggggaaaacaactgcagaggatgggaaatgctatactgccatgcctggaaacacccacaggaaaattaccagttttgagcttgctcaactgcaagaaaaactgaaggagacagaagcagccatggaaaaattattcaacagagtgggacctaatggtgagagagcacagactgtgacttctgaccaagagaaacggttgctacatcagctccgagaaatcaccagggtcatgaaagaaggaaaattcattgacagattttctccagagaaagaagctgaggaggccccttacatggaggactgggaaggttaccctgaagagacttacccaatttatgacctttcagactgtatcaagcgtaggcaagaaacaatcttggtggattaccctgacccaaaagaactttctgctgaagaaatagctgaaagaatgggaatgatagaagaggaagaatcagatcatttgggttgggaaagtctgcccactgaccccagagcccaggaagataattctgttacctcgtgtgatccaaagccagaaacatgttcctgctgttttcatgaagacgaggatcctgctgtcttggcagagaatgctggattcagtgcagatagctaccctgagcaagaggaaaccaccaaagaagagtggtcccaagactttaaagatgaagggttgggcatcagcacagataaagcatatacaggcagcatgctgaggaagcgtaacccccagggtttagagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 - leucine rich repeat and fibronectin type III domain containing 4 - eukaryotic translation initiation factor 4E binding protein 2 - spermatogenesis and oogenesis specific basic helix-loop-helix 2 |