Login to display prices
Login to display prices
CGA-glycoprotein hormones, alpha polypeptide Gene View larger

CGA-glycoprotein hormones, alpha polypeptide Gene

PTXBC010957

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CGA-glycoprotein hormones, alpha polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CGA-glycoprotein hormones, alpha polypeptide Gene

Proteogenix catalog: PTXBC010957
Ncbi symbol: CGA
Product name: CGA-glycoprotein hormones, alpha polypeptide Gene
Size: 2ug
Accessions: BC010957
Gene id: 1081
Gene description: glycoprotein hormones, alpha polypeptide
Synonyms: CG-ALPHA; FSHA; GPHA1; GPHa; LHA; TSHA; glycoprotein hormones alpha chain; FSH-alpha; LSH-alpha; TSH-alpha; anterior pituitary glycoprotein hormones common subunit alpha; choriogonadotropin alpha chain; chorionic gonadotrophin subunit alpha; chorionic gonadotropin, alpha polypeptide; follicle-stimulating hormone alpha chain; follicle-stimulating hormone alpha subunit; follitropin alpha chain; luteinizing hormone alpha chain; lutropin alpha chain; thyroid-stimulating hormone alpha chain; thyrotropin alpha chain; glycoprotein hormones, alpha polypeptide
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggattactacagaaaatatgcagctatctttctggtcacattgtcggtgtttctgcatgttctccattccgctcctgatgtgcaggattgcccagaatgcacgctacaggaaaacccactcttctcccagccgggtgccccaatacttcagtgcatgggctgctgcttctctagagcatatcccactccactaaggtccaagaagacgatgttggtccaaaagaacgtcacctcagagtccacttgctgtgtagctaaatcatataacagggtcacagtaatggggggtttcaaagtggagaaccacacggcgtgccactgcagtacttgttattatcacaaatcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: