Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LSM10-LSM10, U7 small nuclear RNA associated Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LSM10-LSM10, U7 small nuclear RNA associated Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007623 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LSM10 |
| Origin species: | Human |
| Product name: | LSM10-LSM10, U7 small nuclear RNA associated Gene |
| Size: | 2ug |
| Accessions: | BC007623 |
| Gene id: | 84967 |
| Gene description: | LSM10, U7 small nuclear RNA associated |
| Synonyms: | LSM10, U7 small nuclear RNA associated; U7 snRNP-specific Sm-like protein LSM10; U7 snRNA-associated Sm-like protein LSm10; MST074; MSTP074 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggtgagccattcagtgaaggagcggaccatctctgagaacagcctgatcatcctactgcagggcctccagggccgggtaaccactgtggacctgcgggatgagagcgtggcccacggacgcatagacaatgtcgatgctttcatgaacatccgcctggccaaagtcacctacacggaccgttgggggcatcaggtcaagctggatgacctctttgtgacaggccgcaatgtccgctacgtccacatcccagatgacgtgaacatcacctcgaccattgagcagcagctgcagattatccatcgggtgcgaaactttggtggcaagggccaaggccggtgggaatttcccccaaaaaactgtaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 11 open reading frame 52 - chromosome 6 open reading frame 125 - chromosome 12 open reading frame 57 - chromosome 15 open reading frame 39 |