LSM10-LSM10, U7 small nuclear RNA associated Gene View larger

LSM10-LSM10, U7 small nuclear RNA associated Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LSM10-LSM10, U7 small nuclear RNA associated Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LSM10-LSM10, U7 small nuclear RNA associated Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007623
Product type: DNA & cDNA
Ncbi symbol: LSM10
Origin species: Human
Product name: LSM10-LSM10, U7 small nuclear RNA associated Gene
Size: 2ug
Accessions: BC007623
Gene id: 84967
Gene description: LSM10, U7 small nuclear RNA associated
Synonyms: LSM10, U7 small nuclear RNA associated; U7 snRNP-specific Sm-like protein LSM10; U7 snRNA-associated Sm-like protein LSm10; MST074; MSTP074
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggtgagccattcagtgaaggagcggaccatctctgagaacagcctgatcatcctactgcagggcctccagggccgggtaaccactgtggacctgcgggatgagagcgtggcccacggacgcatagacaatgtcgatgctttcatgaacatccgcctggccaaagtcacctacacggaccgttgggggcatcaggtcaagctggatgacctctttgtgacaggccgcaatgtccgctacgtccacatcccagatgacgtgaacatcacctcgaccattgagcagcagctgcagattatccatcgggtgcgaaactttggtggcaagggccaaggccggtgggaatttcccccaaaaaactgtaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 11 open reading frame 52
- chromosome 6 open reading frame 125
- chromosome 12 open reading frame 57
- chromosome 15 open reading frame 39

Buy LSM10-LSM10, U7 small nuclear RNA associated Gene now

Add to cart