C11orf52-chromosome 11 open reading frame 52 Gene View larger

C11orf52-chromosome 11 open reading frame 52 Gene

PTXBC008501

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf52-chromosome 11 open reading frame 52 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf52-chromosome 11 open reading frame 52 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008501
Product type: DNA & cDNA
Ncbi symbol: C11orf52
Origin species: Human
Product name: C11orf52-chromosome 11 open reading frame 52 Gene
Size: 2ug
Accessions: BC008501
Gene id: 91894
Gene description: chromosome 11 open reading frame 52
Synonyms: chromosome 24 open reading frame, human C11orf52; C24H11orf52
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaaaccgggtctgctgcggaggaagctggagctgcccatcaactttccagaagaaaaagaaaagaggaagccaaacaagacggacactgaagccgcagccacaacagctgcagcagaatctcccaaagggccatgaaacaacaggacatacgtatgaacgggtgttacagcagcaagggtctcaagagaggagtccaggcctcatgtcggaagacagcaacttacattatgctgacattcaagtgtgcagccgtccccatgcccgggaagtgaaacacgtgcatttagaaaacgctacagagtatgcgacccttcgcttcccccaggccacacctcgctatgacagcaagaacgggaccctggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 6 open reading frame 125
- chromosome 12 open reading frame 57
- chromosome 15 open reading frame 39
- chromosome 20 open reading frame 24

Buy C11orf52-chromosome 11 open reading frame 52 Gene now

Add to cart