Login to display prices
Login to display prices
C10orf32-chromosome 10 open reading frame 32 Gene View larger

C10orf32-chromosome 10 open reading frame 32 Gene

PTXBC015994

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf32-chromosome 10 open reading frame 32 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf32-chromosome 10 open reading frame 32 Gene

Proteogenix catalog: PTXBC015994
Ncbi symbol: C10orf32
Product name: C10orf32-chromosome 10 open reading frame 32 Gene
Size: 2ug
Accessions: BC015994
Gene id: 119032
Gene description: chromosome 10 open reading frame 32
Synonyms: UPF0693 protein C10orf32; C10orf32; BLOC-1-related complex subunit 7; diaskedin; BLOC-1 related complex subunit 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgactggaacgccagagtctcaagcgcggttcggtcagtccgtgaaggggcttctcacggagaaggtgaccacctgtggtactgacgtaatcgcgctcaccaagcaggtgctgaaaggctcccggagctccgagctgctaggtcaggcagctcgaaacatggtactccaggaagatgccatcttgcactcagaagatagtttaaggaagatggcaataataacaacacatcttcaataccagcaagaagctattcagaagaatgttgaacagtcatcggatctacaggaccagttgaatcatctgttgaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: