C10orf32-chromosome 10 open reading frame 32 Gene View larger

C10orf32-chromosome 10 open reading frame 32 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf32-chromosome 10 open reading frame 32 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf32-chromosome 10 open reading frame 32 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015994
Product type: DNA & cDNA
Ncbi symbol: C10orf32
Origin species: Human
Product name: C10orf32-chromosome 10 open reading frame 32 Gene
Size: 2ug
Accessions: BC015994
Gene id: 119032
Gene description: chromosome 10 open reading frame 32
Synonyms: UPF0693 protein C10orf32; C10orf32; BLOC-1-related complex subunit 7; diaskedin; BLOC-1 related complex subunit 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgactggaacgccagagtctcaagcgcggttcggtcagtccgtgaaggggcttctcacggagaaggtgaccacctgtggtactgacgtaatcgcgctcaccaagcaggtgctgaaaggctcccggagctccgagctgctaggtcaggcagctcgaaacatggtactccaggaagatgccatcttgcactcagaagatagtttaaggaagatggcaataataacaacacatcttcaataccagcaagaagctattcagaagaatgttgaacagtcatcggatctacaggaccagttgaatcatctgttgaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 17 open reading frame 37
- glycoprotein hormones, alpha polypeptide
- chromosome 20 open reading frame 30
- ribosomal protein L23a pseudogene 7

Buy C10orf32-chromosome 10 open reading frame 32 Gene now

Add to cart