Login to display prices
Login to display prices
RPL23AP7-ribosomal protein L23a pseudogene 7 Gene View larger

RPL23AP7-ribosomal protein L23a pseudogene 7 Gene

PTXBC000596

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL23AP7-ribosomal protein L23a pseudogene 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL23AP7-ribosomal protein L23a pseudogene 7 Gene

Proteogenix catalog: PTXBC000596
Ncbi symbol: RPL23AP7
Product name: RPL23AP7-ribosomal protein L23a pseudogene 7 Gene
Size: 2ug
Accessions: BC000596
Gene id: 118433
Gene description: ribosomal protein L23a pseudogene 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcactcaccttcaggcggcccaagacactgcgactccggaggcagcccagatatcctcagaagagcacccccaggagaaacaagcttggccactatgctatcatcaagtttccgctgaccactgagtcggccgtgaagaagatagaagaaaacaacacgcttgtgttcactgtggatgttaaagccaacaagcaccagatcagacaggctgtgaagaagctctatgacagtgatgtggccaaggtcaccaccctgatttgtcctgataaagagaagaaggcatatgttcgacttgctcctgattatgatgctttcaatgttgtaacaaaattgggatcacctaaactgagtccagctggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: