C12orf57-chromosome 12 open reading frame 57 Gene View larger

C12orf57-chromosome 12 open reading frame 57 Gene

PTXBC009925

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C12orf57-chromosome 12 open reading frame 57 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C12orf57-chromosome 12 open reading frame 57 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009925
Product type: DNA & cDNA
Ncbi symbol: C12orf57
Origin species: Human
Product name: C12orf57-chromosome 12 open reading frame 57 Gene
Size: 2ug
Accessions: BC009925
Gene id: 113246
Gene description: chromosome 12 open reading frame 57
Synonyms: C10; GRCC10; protein C10; likely ortholog of mouse gene rich cluster, C10; chromosome 12 open reading frame 57
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtccgcctcgacccaaccggcggccttgagcgctgagcaagcaaaggtggtcctcgcggaggtgatccaggcgttctccgccccggagaatgcagtgcgcatggacgaggctcgggataacgcctgcaacgacatgggtaagatgctgcaattcgtgctgcccgtggccacgcagatccagcaggaggttatcaaagcctatggcttcagctgcgacggggaaggtgtccttaagtttgctcgcttggtcaagtcctacgaagcccaggatcctgagatcgccagcctgtcaggcaagctgaaggcgctgtttctgccgcccatgaccctgccaccccatgggcctgctgctggtggcagcgtggccgcctcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 15 open reading frame 39
- chromosome 20 open reading frame 24
- chromosome 1 open reading frame 123
- chromosome 11 open reading frame 59

Buy C12orf57-chromosome 12 open reading frame 57 Gene now

Add to cart