Login to display prices
Login to display prices
C1orf123-chromosome 1 open reading frame 123 Gene View larger

C1orf123-chromosome 1 open reading frame 123 Gene

PTXBC010908

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf123-chromosome 1 open reading frame 123 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf123-chromosome 1 open reading frame 123 Gene

Proteogenix catalog: PTXBC010908
Ncbi symbol: C1orf123
Product name: C1orf123-chromosome 1 open reading frame 123 Gene
Size: 2ug
Accessions: BC010908
Gene id: 54987
Gene description: chromosome 1 open reading frame 123
Synonyms: UPF0587 protein C1orf123; chromosome 1 open reading frame 123
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaaaatcgcgctgcaactcaaagccacgctggagaacatcaccaacctccggcccgtgggcgaggacttccggtggtacctgaagatgaaatgtggcaactgtggtgagatttcggacaagtggcagtacatccggctgatggacagtgtggcactgaaggggggccgtggcagtgcttccatggtccagaagtgcaagctgtgtgcaagagaaaattccatcgagattttaagcagcaccatcaagccttacaatgctgaagacaatgagaacttcaagacaatagtggagtttgagtgccggggccttgaaccagttgatttccagccgcaggctgggtttgctgctgaaggtgtggagtcagggacagccttcagtgacattaatctgcaggagaaggactggactgactatgatgaaaaggcccaggagtctgtgggaatctatgaggtcacccaccagtttgtgaagtgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: