C11orf59-chromosome 11 open reading frame 59 Gene View larger

C11orf59-chromosome 11 open reading frame 59 Gene

PTXBC001706

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf59-chromosome 11 open reading frame 59 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf59-chromosome 11 open reading frame 59 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001706
Product type: DNA & cDNA
Ncbi symbol: C11orf59
Origin species: Human
Product name: C11orf59-chromosome 11 open reading frame 59 Gene
Size: 2ug
Accessions: BC001706
Gene id: 55004
Gene description: chromosome 11 open reading frame 59
Synonyms: RhoA activator C11orf59; C11orf59; PDRO; Ragulator1; p18; p27RF-Rho; ragulator complex protein LAMTOR1; late endosomal/lysosomal adaptor and MAPK and MTOR activator 1; lipid raft adaptor protein p18; p27Kip1-releasing factor from RhoA; p27kip1 releasing factor from RhoA; protein associated with DRMs and endosomes; ragulator complex protein PDRO; late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggtgctgctacagcagcgagaacgaggactcggaccaggaccgagaggagcggaagctgctgctggaccctagcagcccccctaccaaagctctcaatggagccgagcccaactaccacagcctgccttccgctcgcactgatgagcaggccctgctctcttccatccttgccaagacagccagcaacatcattgatgtgtctgctgcagactcacagggcatggagcagcatgagtacatggaccgtgccaggcagtacagcacccgcttggctgtgctgagcagcagcctgacccattggaagaagctgccaccgctgccgtctcttaccagccagccccaccaagtgctggccagtgagcccatcccgttctctgatttgcagcaggtctccaggatagctgcttatgcctacagtgcactttctcagatccgtgtggacgcaaaagaggagctggttgtacagtttgggatcccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 15 open reading frame 15
- chromosome 15 open reading frame 15
- chromosome 1 open reading frame 149
- chromosome 16 open reading frame 68

Buy C11orf59-chromosome 11 open reading frame 59 Gene now

Add to cart