C15orf15-chromosome 15 open reading frame 15 Gene View larger

C15orf15-chromosome 15 open reading frame 15 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C15orf15-chromosome 15 open reading frame 15 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C15orf15-chromosome 15 open reading frame 15 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014576
Product type: DNA & cDNA
Ncbi symbol: C15orf15
Origin species: Human
Product name: C15orf15-chromosome 15 open reading frame 15 Gene
Size: 2ug
Accessions: BC014576
Gene id: 51187
Gene description: chromosome 15 open reading frame 15
Synonyms: C15orf15; HRP-L30-iso; L30; RLP24; RPL24; RPL24L; TVAS3; 60S ribosomal protein L30 isolog; homolog of yeast ribosomal like protein 24; my024 protein; ribosomal L24 domain-containing protein 1; ribosomal L24 domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgtatcgaaaagtgttatttctgttcggggcccatctatcctggacacggcatgatgttcgtccgcaacgattgcaaggtgttcggattttgcaaatctaaatgtcataaaaactttaaaaagaagcgcaatcctcgcaaagttaggtggaccaaagcattccggaaagcagctggtaaagagcttacagtggataattcatttgaatttgaaaaacgtagaaatgagcctatcaaataccagcgagagctatggaataaaactattgatgcgatgaagagagttgaagaaatcaaacagaagcgccaagctaaatttataatgaacagattgaagaaaaataaagagctacagaaagttcaggatatcaaagaagtcaagcaaaacatccatcttatccgagcccctcttgcaggcaaagggaaacagttggaagagaaaatggtacagcagttacaagaggatgtggacatggaagatgctccttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 15 open reading frame 15
- chromosome 1 open reading frame 149
- chromosome 16 open reading frame 68
- chromosome 19 open reading frame 40

Buy C15orf15-chromosome 15 open reading frame 15 Gene now

Add to cart