C17orf37-chromosome 17 open reading frame 37 Gene View larger

C17orf37-chromosome 17 open reading frame 37 Gene

PTXBC006006

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C17orf37-chromosome 17 open reading frame 37 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C17orf37-chromosome 17 open reading frame 37 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006006
Product type: DNA & cDNA
Ncbi symbol: C17orf37
Origin species: Human
Product name: C17orf37-chromosome 17 open reading frame 37 Gene
Size: 2ug
Accessions: BC006006
Gene id: 84299
Gene description: chromosome 17 open reading frame 37
Synonyms: protein C17orf37; C17orf37; C35; ORB3; RDX12; XTP4; migration and invasion enhancer 1; HBV X-transactivated gene 4 protein; HBV XAg-transactivated protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcggggagccggggcagacgtccgtagcgccccctcccgaggaggtcgagccgggcagtggggtccgcatcgtggtggagtactgtgaaccctgcggcttcgaggcgacctacctggagctggccagtgctgtgaaggagcagtatccgggcatcgagatcgagtcgcgcctcgggggcacaggtgcctttgagatagagataaatggacagctggtgttctccaagctggagaatgggggctttccctatgagaaagatctcattgaggccatccgaagagccagtaatggagaaaccctagaaaagatcaccaacagccgtcctccctgcgtcatcctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glycoprotein hormones, alpha polypeptide
- chromosome 20 open reading frame 30
- ribosomal protein L23a pseudogene 7
- LSM10, U7 small nuclear RNA associated

Buy C17orf37-chromosome 17 open reading frame 37 Gene now

Add to cart