Login to display prices
Login to display prices
C20orf30-chromosome 20 open reading frame 30 Gene View larger

C20orf30-chromosome 20 open reading frame 30 Gene

PTXBC009768

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf30-chromosome 20 open reading frame 30 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf30-chromosome 20 open reading frame 30 Gene

Proteogenix catalog: PTXBC009768
Ncbi symbol: C20orf30
Product name: C20orf30-chromosome 20 open reading frame 30 Gene
Size: 2ug
Accessions: BC009768
Gene id: 29058
Gene description: chromosome 20 open reading frame 30
Synonyms: UPF0414 transmembrane protein C20orf30; C20orf30; HSPC274; dJ1116H23.2.1; transmembrane protein 230
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgccgtcccgtaccaacctggctactggaatccccagtagtaaagtgaaatattcaaggctctccagcacagacgatggctacattgaccttcagtttaagaaaacccctcctaagatcccttataaggccatcgcacttgccactgtgctgtttttgattggcgcctttctcattattataggctccctcctgctgtcaggctacatcagcaaagggggggcagaccgggccgttccagtgctgatcattggcattctggtgttcctacccggattttaccacctgcgcatcgcttactatgcatccaaaggctaccgtggttactcctatgatgacattccagactttgatgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: