RPS26-ribosomal protein S26 Gene View larger

RPS26-ribosomal protein S26 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS26-ribosomal protein S26 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPS26-ribosomal protein S26 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002604
Product type: DNA & cDNA
Ncbi symbol: RPS26
Origin species: Human
Product name: RPS26-ribosomal protein S26 Gene
Size: 2ug
Accessions: BC002604
Gene id: 6231
Gene description: ribosomal protein S26
Synonyms: DBA10; S26; 40S ribosomal protein S26; ribosomal protein S26
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaaagaaaagaaggaacaatggtcgtgccaaaaagggccgcggccacgtgcagcctattcgctgcactaactgtgcccgatgcgtgcccaaggacaaggccattaagaaattcgtcattcgaaacatagtggaggccgcagcagtcagggacatttctgaagcgagcgtcttcgatgcctatgtgcttcccaagctgtatgtgaagctacattactgtgtgagttgtgcaattcacagcaaagtagtcaggaatcgatctcgtgaagcccgcaaggaccgaacacccccaccccgatttagacctgcgggtgctgccccacgtcccccaccaaagcccatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S25
- ribosomal protein L31
- ribosomal protein S24
- ribosomal protein S12

Buy RPS26-ribosomal protein S26 Gene now

Add to cart