RPS24-ribosomal protein S24 Gene View larger

RPS24-ribosomal protein S24 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS24-ribosomal protein S24 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPS24-ribosomal protein S24 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000523
Product type: DNA & cDNA
Ncbi symbol: RPS24
Origin species: Human
Product name: RPS24-ribosomal protein S24 Gene
Size: 2ug
Accessions: BC000523
Gene id: 6229
Gene description: ribosomal protein S24
Synonyms: DBA3; S24; 40S ribosomal protein S24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacgacaccgtaactatccgcactagaaagttcatgaccaaccgactacttcagaggaaacaaatggtcattgatgtccttcaccccgggaaggcgacagtgcctaagacagaaattcgggaaaaactagccaaaatgtacaagaccacaccggatgtcatctttgtatttggattcagaactcattttggtggtggcaagacaactggctttggcatgatttatgattccctggattatgcaaagaaaaatgaacccaaacatagacttgcaagacatggcctgtatgagaagaaaaagacctcaagaaagcaacgaaaggaacgcaagaacagaatgaagaaagtcagggggactgcaaaggccaatgttggtgctggcaaaaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S12
- ribosomal protein S17
- ribosomal protein L28
- ribosomal protein L23

Buy RPS24-ribosomal protein S24 Gene now

Add to cart