RPS12-ribosomal protein S12 Gene View larger

RPS12-ribosomal protein S12 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS12-ribosomal protein S12 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPS12-ribosomal protein S12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017321
Product type: DNA & cDNA
Ncbi symbol: RPS12
Origin species: Human
Product name: RPS12-ribosomal protein S12 Gene
Size: 2ug
Accessions: BC017321
Gene id: 6206
Gene description: ribosomal protein S12
Synonyms: S12; 40S ribosomal protein S12; ribosomal protein S12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgaggaaggcattgctgctggaggtgtaatggacgttaatactgctttacaagaggttctgaagactgccctcatccacgatggcctagcacgtggaattcgcgaagctgccaaagccttagacaagcgccaagcccatctttgtgtgcttgcatccaactgtgatgagcctatgtatgtcaagttggtggaggccctttgtgctgaacaccaaatcaacctaattaaggttgatgacaacaagaaactaggagaatgggtaggcctttgtaaaattgacagagaggggaaaccccgtaaagtggttggttgcagttgtgtagtagttaaggactatggcaaggagtctcaggccaaggatgtcattgaagagtatttcaaatgcaagaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S17
- ribosomal protein L28
- ribosomal protein L23
- carbonic anhydrase XII

Buy RPS12-ribosomal protein S12 Gene now

Add to cart