Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CA12-carbonic anhydrase XII Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CA12-carbonic anhydrase XII Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001012 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CA12 |
| Origin species: | Human |
| Product name: | CA12-carbonic anhydrase XII Gene |
| Size: | 2ug |
| Accessions: | BC001012 |
| Gene id: | 771 |
| Gene description: | carbonic anhydrase XII |
| Synonyms: | CA-XII; CAXII; HsT18816; T18816; carbonic anhydrase 12; carbonate dehydratase XII; carbonic anhydrase XII; carbonic dehydratase; tumor antigen HOM-RCC-3.1.3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgaagcaacatgaattagggggcctcttggccttggtccaaaattgtcaatcagaaatgaacataaaggactccagagcagtgggactgtctgtcaaaagactctgtatatcttttgtggatgagttttgtgagagaacagagagaccattgtacctggcacaagggctcttcatgaaaagggagacttactgggaggtgcaagacagtggcatttctcctctcctcttgctgctcagcacagccctggattgcagccccgaggctgagaccagacaaagcccgggaggcagaaagatgctccaagaaccaacactatcaatgtctttgcaaatcctcacaggattcctgtgggtccagctttggaactgggaaacctttcttcggatccgcactcattccactgatgccagctgcccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - testis expressed 261 - ribosomal protein S11 - titin-cap (telethonin) - ribosomal protein L11 |