Login to display prices
Login to display prices
RPS11-ribosomal protein S11 Gene View larger

RPS11-ribosomal protein S11 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS11-ribosomal protein S11 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPS11-ribosomal protein S11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007283
Product type: DNA & cDNA
Ncbi symbol: RPS11
Origin species: Human
Product name: RPS11-ribosomal protein S11 Gene
Size: 2ug
Accessions: BC007283
Gene id: 6205
Gene description: ribosomal protein S11
Synonyms: S11; 40S ribosomal protein S11; ribosomal protein S11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacattcagactgagcgtgcctaccaaaagcagccgaccatctttcaaaacaagaagagggtcctgctgggagaaactggcaaggagaagctcccgcggtactacaagaacatcggtctgggcttcaagacacccaaggaggctattgagggcacctacattgacaagaaatgccccttcactggtaatgtgtccattcgagggcggatcctctctggcgtggtgaccaagatgaagatgcagaggaccattgtcatccgccgagactatctgcactacatccgcaagtacaaccgcttcgagaagcgccacaagaacatgtctgtacacctgtccccctgcttcagggacgtccagatcggtgacatcgtcacagtgggcgagtgccggcctctgagcaagacagtgcgcttcaacgtgctcaaggtcaccaaggctgccggcaccaagaagcagttccagaagttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - titin-cap (telethonin)
- ribosomal protein L11
- ribosomal protein L17
- histone deacetylase 7