RPL17-ribosomal protein L17 Gene View larger

RPL17-ribosomal protein L17 Gene

PTXBC000502

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL17-ribosomal protein L17 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL17-ribosomal protein L17 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000502
Product type: DNA & cDNA
Ncbi symbol: RPL17
Origin species: Human
Product name: RPL17-ribosomal protein L17 Gene
Size: 2ug
Accessions: BC000502
Gene id: 6139
Gene description: ribosomal protein L17
Synonyms: L17; PD-1; RPL23; 60S ribosomal protein L17; 60S ribosomal protein L23; gene encoding putative NFkB activating protein; ribosomal protein L17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttcgctattcacttgacccggagaaccccacgaaatcatgcaaatcaagaggttccaatcttcgtgttcactttaagaacactcgtgaaactgctcaggccatcaagggtatgcatatacgaaaagccacgaagtatctgaaagatgtcactttacagaaacagtgtgtaccattccgacgttacaatggtggagttggcaggtgtgcgcaggccaagcaatggggctggacacaaggtcggtggcccaaaaagagtgctgaatttttgctgcacatgcttaaaaacgcagagagtaatgctgaacttaagggtttagatgtagattctctggtcattgagcatatccaagtgaacaaagcacctaagatgcgccgccggacctacagagctcatggtcggattaacccatacatgagctctccctgccacattgagatgatccttacggaaaaggaacagattgttcctaaaccagaagaggaggttgcccagaagaaaaagatatcccagaagaaactgaagaaacaaaaacttatggcacgggagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - histone deacetylase 7
- CHMP family, member 7
- exostoses (multiple) 1
- oxidation resistance 1

Buy RPL17-ribosomal protein L17 Gene now

Add to cart