HDAC7-histone deacetylase 7 Gene View larger

HDAC7-histone deacetylase 7 Gene

New product

698,39 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HDAC7-histone deacetylase 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HDAC7-histone deacetylase 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006453
Product type: DNA & cDNA
Ncbi symbol: HDAC7
Origin species: Human
Product name: HDAC7-histone deacetylase 7 Gene
Size: 2ug
Accessions: BC006453
Gene id: 51564
Gene description: histone deacetylase 7
Synonyms: HD7; HD7A; HDAC7A; histone deacetylase 7; histone deacetylase 7A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcttctgcttcttcaactcagtggccatcgcctgccggcagctgcaacagcagagcaaggccagcaagatcctcattgtagactgggacgtgcaccatggcaacggcacccagcaaaccttctaccaagaccccagtgtgctctacatctccctgcatcgccatgacgacggcaacttcttcccggggagtggggctgtggatgaggtaggggctggcagcggtgagggcttcaatgtcaatgtggcctgggctggaggtctggacccccccatgggggatcctgagtacctggctgctttcaggatagtcgtgatgcccatcgcccgagagttctctccagacctagtcctggtgtctgctggatttgatgctgctgagggtcacccggccccactgggtggctaccatgtttctgccaaatgttttggatacatgacgcagcaactgatgaacctggcaggaggcgcagtggtgctggccttggagggtggccatgacctcacagccatctgtgacgcctctgaggcctgtgtggctgctcttctgggtaacagggtggatcccctttcagaagaaggctggaaacagaaacccaacctcaatgccatccgctctctggaggccgtgatccgggtgcacagtaaatactggggctgcatgcagcgcctggcctcctgtccagactcctgggtgcctagagtgccaggggctgacaaagaagaagtggaggcagtgaccgcactggcgtccctctctgtgggcatcctggctgaagataggccctcggagcagctggtggaggaggaagaacctatgaatctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CHMP family, member 7
- exostoses (multiple) 1
- oxidation resistance 1
- feline sarcoma oncogene

Buy HDAC7-histone deacetylase 7 Gene now

Add to cart