TCAP-titin-cap (telethonin) Gene View larger

TCAP-titin-cap (telethonin) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TCAP-titin-cap (telethonin) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TCAP-titin-cap (telethonin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013330
Product type: DNA & cDNA
Ncbi symbol: TCAP
Origin species: Human
Product name: TCAP-titin-cap (telethonin) Gene
Size: 2ug
Accessions: BC013330
Gene id: 8557
Gene description: titin-cap (telethonin)
Synonyms: CMD1N; CMH25; LGMD2G; T-cap; TELE; 19 kDa sarcomeric protein; limb girdle muscular dystrophy 2G (autosomal recessive); teneurin C-terminal associated peptide; titin cap protein; titin-cap
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctacctcagagctgagctgcgaggtgtcggaggagaactgtgagcgccgggaggccttctgggcagaatggaaggatctgacactgtccacacggcccgaggagggctgctccctgcatgaggaggacacccagagacatgagacctaccaccagcaggggcagtgccaggtgctggtgcagcgctcgccctggctgatgatgcggatgggcatccacggccgtgggctgcaggagtaccagctgccctaccagcgggtactgccgctgcccatcttcacccctgccaagatgggcgccaccaaggaggagcgtgaggacacccccatccagcttcaggagctgctggcgctggagacagccctgggtggccagtgtgtggaccgccaggaggtggctgagatcacaaagcagctgccccctgtggtgcctgtcagcaagcccggtgcccttcgtcgctccctgtcccgctccatgtcccaggaagcacagagaggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L11
- ribosomal protein L17
- histone deacetylase 7
- CHMP family, member 7

Buy TCAP-titin-cap (telethonin) Gene now

Add to cart