RPL31-ribosomal protein L31 Gene View larger

RPL31-ribosomal protein L31 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL31-ribosomal protein L31 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPL31-ribosomal protein L31 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017343
Product type: DNA & cDNA
Ncbi symbol: RPL31
Origin species: Human
Product name: RPL31-ribosomal protein L31 Gene
Size: 2ug
Accessions: BC017343
Gene id: 6160
Gene description: ribosomal protein L31
Synonyms: L31; 60S ribosomal protein L31; ribosomal protein L31
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcccgcaaagaagggtggcgagaagaaaaagggccgttctgccatcaacgaagtggtaacccgagaatacaccatcaacattcacaagcgcatccatggagtgggcttcaagaagcgtgcacctcgggcactcaaagagattcggaaatttgccatgaaggagatgggaactccagatgtgcgcattgacaccaggctcaacaaagctgtctgggccaaaggaataaggaatgtgccataccgaatccgtgtgcggctgtccagaaaacgtaatgaggatgaagattcaccaaataagctatatactttggttacctatgtacctgttaccactttcaaaaatctacagacagtcaatgtggatgagaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S24
- ribosomal protein S12
- ribosomal protein S17
- ribosomal protein L28

Buy RPL31-ribosomal protein L31 Gene now

Add to cart