RPS25-ribosomal protein S25 Gene View larger

RPS25-ribosomal protein S25 Gene

PTXBC003537

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS25-ribosomal protein S25 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPS25-ribosomal protein S25 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003537
Product type: DNA & cDNA
Ncbi symbol: RPS25
Origin species: Human
Product name: RPS25-ribosomal protein S25 Gene
Size: 2ug
Accessions: BC003537
Gene id: 6230
Gene description: ribosomal protein S25
Synonyms: S25; 40S ribosomal protein S25
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcctaaggacgacaagaagaagaaggacgctggaaagtcggccaagaaagacaaagacccagtgaacaaatccgggggcaaggccaaaaagaagaagtggtccaaaggcaaagttcgggacaagctcaataacttagtcttgtttgacaaagctacctatgataaactctgtaaggaagttcccaactataaacttataaccccagctgtggtctctgagagactgaagattcgaggctccctggccagggcagcccttcaggagctccttagtaaaggacttatcaaactggtttcaaagcacagagctcaagtaatttacaccagaaataccaagggtggagatgctccagctgctggtgaagatgcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L31
- ribosomal protein S24
- ribosomal protein S12
- ribosomal protein S17

Buy RPS25-ribosomal protein S25 Gene now

Add to cart