MGC16291-hypothetical protein MGC16291 Gene View larger

MGC16291-hypothetical protein MGC16291 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC16291-hypothetical protein MGC16291 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MGC16291-hypothetical protein MGC16291 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007394
Product type: DNA & cDNA
Ncbi symbol: MGC16291
Origin species: Human
Product name: MGC16291-hypothetical protein MGC16291 Gene
Size: 2ug
Accessions: BC007394
Gene id: 84856
Gene description: hypothetical protein MGC16291
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggaggctggaggcagtgacgcagcaacagcgcgaggcgactttggagcggcctcatatagcgacctcgccttccgctgcgcgtcctcccagagcccaagaagcccggaacctgtggcatccatctctgaaaggagaagacggcaacccagccgaggcactactgggttggggtctccacgaccgagctggtctcatcaagtggcgtccaacaaggggctcaaacccgggttgaggggttgctggagcgacggagaacgtggaactacactggaggacaccagagtactcttaagcaatcccttgtctgcagatgtggatcccgaatcctgcgagaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein MGC14425
- methylthioadenosine phosphorylase
- SEC11 homolog A (S. cerevisiae)
- hypothetical protein MGC29506

Buy MGC16291-hypothetical protein MGC16291 Gene now

Add to cart