MGC14425-hypothetical protein MGC14425 Gene View larger

MGC14425-hypothetical protein MGC14425 Gene

PTXBC007866

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC14425-hypothetical protein MGC14425 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC14425-hypothetical protein MGC14425 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007866
Product type: DNA & cDNA
Ncbi symbol: MGC14425
Origin species: Human
Product name: MGC14425-hypothetical protein MGC14425 Gene
Size: 2ug
Accessions: BC007866
Gene id: 84989
Gene description: hypothetical protein MGC14425
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccccgctcgccagcttcgccagccgcgtccgctctcccagcgctccgaacgtgcctcgtcgccgaccgccacacacaggaaccgcttacccaccagctctgcccgcgtctctaccgccatagctgtcgctgccgaagcggccgctgcctcctccagtgcgagggaaccgatgaaacctcactcttaccggccgctcatgctgaggagagcggaccgggacacagcagcggacccgaaagagcgcagactcgggacgaaccggccgctctgccccggacacagcgacctcgggccctccccgcaaacactcctttggactcccagattcgcagccttgtgctgcagcgccacacaagaaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methylthioadenosine phosphorylase
- SEC11 homolog A (S. cerevisiae)
- hypothetical protein MGC29506
- ras homolog gene family, member H

Buy MGC14425-hypothetical protein MGC14425 Gene now

Add to cart