Login to display prices
Login to display prices
MGC14425-hypothetical protein MGC14425 Gene View larger

MGC14425-hypothetical protein MGC14425 Gene

PTXBC007866

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC14425-hypothetical protein MGC14425 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC14425-hypothetical protein MGC14425 Gene

Proteogenix catalog: PTXBC007866
Ncbi symbol: MGC14425
Product name: MGC14425-hypothetical protein MGC14425 Gene
Size: 2ug
Accessions: BC007866
Gene id: 84989
Gene description: hypothetical protein MGC14425
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccccgctcgccagcttcgccagccgcgtccgctctcccagcgctccgaacgtgcctcgtcgccgaccgccacacacaggaaccgcttacccaccagctctgcccgcgtctctaccgccatagctgtcgctgccgaagcggccgctgcctcctccagtgcgagggaaccgatgaaacctcactcttaccggccgctcatgctgaggagagcggaccgggacacagcagcggacccgaaagagcgcagactcgggacgaaccggccgctctgccccggacacagcgacctcgggccctccccgcaaacactcctttggactcccagattcgcagccttgtgctgcagcgccacacaagaaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: