MGC29506-hypothetical protein MGC29506 Gene View larger

MGC29506-hypothetical protein MGC29506 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC29506-hypothetical protein MGC29506 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MGC29506-hypothetical protein MGC29506 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021275
Product type: DNA & cDNA
Ncbi symbol: MGC29506
Origin species: Human
Product name: MGC29506-hypothetical protein MGC29506 Gene
Size: 2ug
Accessions: BC021275
Gene id: 51237
Gene description: hypothetical protein MGC29506
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggctgtcactgccactgctgctgctgctgctgggagcctgggccatcccagggggcctcggggacagggcgccactcacagccacagccccacaactggatgatgaggagatgtactcagcccacatgcccgctcacctgcgctgtgatgcctgcagagctgtggcttaccagatgtggcaaaatctggcaaaggcagagaccaaacttcatacctcaaactctggggggcggcgggagctgagcgagttggtctacacggatgtcctggaccggagctgctcccggaactggcaggactacggagttcgagaagtggaccaagtgaaacgtctcacaggcccaggacttagcgaggggccagagccaagcatcagcgtgatggtcacagggggcccctggcctaccaggctctccaggacatgtttgcactacttgggggagtttggagaagaccagatctatgaagcccaccaacaaggccgaggggctctggaggcattgctatgtgggggaccccagggggcctgctcagagaaggtgtcagccacaagagaagagctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ras homolog gene family, member H
- dual specificity phosphatase 13
- activating transcription factor 6
- ubiquitin-conjugating enzyme E2S

Buy MGC29506-hypothetical protein MGC29506 Gene now

Add to cart