Login to display prices
Login to display prices
MGC29506-hypothetical protein MGC29506 Gene View larger

MGC29506-hypothetical protein MGC29506 Gene

PTXBC021275

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC29506-hypothetical protein MGC29506 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC29506-hypothetical protein MGC29506 Gene

Proteogenix catalog: PTXBC021275
Ncbi symbol: MGC29506
Product name: MGC29506-hypothetical protein MGC29506 Gene
Size: 2ug
Accessions: BC021275
Gene id: 51237
Gene description: hypothetical protein MGC29506
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggctgtcactgccactgctgctgctgctgctgggagcctgggccatcccagggggcctcggggacagggcgccactcacagccacagccccacaactggatgatgaggagatgtactcagcccacatgcccgctcacctgcgctgtgatgcctgcagagctgtggcttaccagatgtggcaaaatctggcaaaggcagagaccaaacttcatacctcaaactctggggggcggcgggagctgagcgagttggtctacacggatgtcctggaccggagctgctcccggaactggcaggactacggagttcgagaagtggaccaagtgaaacgtctcacaggcccaggacttagcgaggggccagagccaagcatcagcgtgatggtcacagggggcccctggcctaccaggctctccaggacatgtttgcactacttgggggagtttggagaagaccagatctatgaagcccaccaacaaggccgaggggctctggaggcattgctatgtgggggaccccagggggcctgctcagagaaggtgtcagccacaagagaagagctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: