Login to display prices
Login to display prices
ATF6-activating transcription factor 6 Gene View larger

ATF6-activating transcription factor 6 Gene

PTXBC014969

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATF6-activating transcription factor 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATF6-activating transcription factor 6 Gene

Proteogenix catalog: PTXBC014969
Ncbi symbol: ATF6
Product name: ATF6-activating transcription factor 6 Gene
Size: 2ug
Accessions: BC014969
Gene id: 22926
Gene description: activating transcription factor 6
Synonyms: ACHM7; ATF6A; cyclic AMP-dependent transcription factor ATF-6 alpha; cAMP-dependent transcription factor ATF-6 alpha; activating transcription factor 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggagccggctggggttgccggcaccatggagtcaccttttagcccgggactctttcacaggctggatgaagattgggattctgctctctttgctgaactcggttatttcacagacactgatgagctgcaattggaagcagcaaatgagacgtatgaaaacaattttgataatcttgattttgatttggatttggtgccttgggagtcagacatttgggacatcaacaaccaaatctgtacagttaaagatattaaggcagaacctcagccactttctccagcctcctcaagttattcagtctcgtctcctcggtcagtggactcttattcttcaactcagcatgttcctgaggagttggatttgtcttctagttctcagatgtctcccctttccttatatggtgaaaactctaatagtctctcttcagcggagccactgaaggaagataagcctgtcactggtcctaggaacaagactgaaaatggactgactccaaagaaaaaaattcaggtgaattcaaaaccttcaattcagcccaagcctttattgcttccagcagcacccaagactcaaacaatctccagcattccccctcaaacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: