Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GDF15-growth differentiation factor 15 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GDF15-growth differentiation factor 15 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000529 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GDF15 |
| Origin species: | Human |
| Product name: | GDF15-growth differentiation factor 15 Gene |
| Size: | 2ug |
| Accessions: | BC000529 |
| Gene id: | 9518 |
| Gene description: | growth differentiation factor 15 |
| Synonyms: | GDF-15; MIC-1; MIC1; NAG-1; PDF; PLAB; PTGFB; growth/differentiation factor 15; NRG-1; NSAID (nonsteroidal anti-inflammatory drug)-activated protein 1; NSAID-activated gene 1 protein; NSAID-regulated gene 1 protein; PTGF-beta; macrophage inhibitory cytokine 1; placental TGF-beta; placental bone morphogenetic protein; prostate differentiation factor; growth differentiation factor 15 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccgggcaagaactcaggacggtgaatggctctcagatgctcctggtgttgctggtgctctcgtggctgccgcatgggggcgccctgtctctggccgaggcgagccgcgcaagtttcccgggaccctcagagttgcactccgaagactccagattccgagagttgcggaaacgctacgaggacctgctaaccaggctgcgggccaaccagagctgggaagattcgaacaccgacctcgtcccggcccctgcagtccggatactcacgccagaagtgcggctgggatccggcggccacctgcacctgcgtatctctcgggccgcccttcccgaggggctccccgaggcctcccgccttcaccgggctctgttccggctgtccccgacggcgtcaaggtcgtgggacgtgacacgaccgctgcggcgtcagctcagccttgcaagaccccaggcgcccgcgctgcacctgcgactgtcgccgccgccgtcgcagtcggaccaactgctggcagaatcttcgtccgcacggccccagctggagttgcacttgcggccgcaagccgccagggggcgccgcagagcgcgtgcgcgcaacggggaccactgtccgctcgggcccgggcgttgctgccgtctgcacacggtccgcgcgtcgctggaagacctgggctgggccgattgggtgctgtcgccacgggaggtgcaagtgaccatgtgcatcggcgcgtgcccgagccagttccgggcggcaaacatgcacgcgcagatcaagacgagcctgcaccgcctgaagcccgacacggtgccagcgccctgctgcgtgcccgccagctacaatcccatggtgctcattcaaaagaccgacaccggggtgtcgctccagacctatgatgacttgttagccaaagactgccactgcatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - calcium homeostasis modulator 2 - TNF receptor-associated factor 4 - glucose-6-phosphate dehydrogenase - DENN/MADD domain containing 1C |