Login to display prices
Login to display prices
DUSP13-dual specificity phosphatase 13 Gene View larger

DUSP13-dual specificity phosphatase 13 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUSP13-dual specificity phosphatase 13 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DUSP13-dual specificity phosphatase 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009778
Product type: DNA & cDNA
Ncbi symbol: DUSP13
Origin species: Human
Product name: DUSP13-dual specificity phosphatase 13 Gene
Size: 2ug
Accessions: BC009778
Gene id: 51207
Gene description: dual specificity phosphatase 13
Synonyms: BEDP; DUSP13A; DUSP13B; MDSP; SKRP4; TMDP; dual specificity protein phosphatase 13; branching-enzyme interacting DSP; branching-enzyme interacting dual-specificity protein phosphatase; muscle-restricted DSP; testis- and skeletal-muscle-specific DSP; dual specificity phosphatase 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactcactgcagaagcaggacctccggaggcccaagatccatggggcagtccaggcatctccctaccagccgcccacattggcttcgctgcagcgcttgctgtgggtccgtcaggctgccacactgaaccatatcgatgaggtctggcccagcctcttcctgggagatgcgtacgcagcccgggacaagagcaagctgatccagctgggaatcacccacgttgtgaatgccgctgcaggcaagttccaggtggacacaggtgccaaattctaccgtggaatgtccctggagtactatggcatcgaggcggatgacaaccccttcttcgacctcagtgtctactttctgcctgttgctcgatacatccgagctgccctcagtgttccccaaggccgcgtgctggtacactgtgccatgggggtaagccgctctgccacacttgtcctggccttcctcatgatctatgagaacatgacgctggtagaggccatccagacggtgcaggcccaccgcaatatctgccctaactcaggcttcctccggcagctccaggttctggacaaccgactggggcgggagacggggcggttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - activating transcription factor 6
- ubiquitin-conjugating enzyme E2S
- growth differentiation factor 15
- calcium homeostasis modulator 2