Login to display prices
Login to display prices
MTAP-methylthioadenosine phosphorylase Gene View larger

MTAP-methylthioadenosine phosphorylase Gene

PTXBC018625

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTAP-methylthioadenosine phosphorylase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MTAP-methylthioadenosine phosphorylase Gene

Proteogenix catalog: PTXBC018625
Ncbi symbol: MTAP
Product name: MTAP-methylthioadenosine phosphorylase Gene
Size: 2ug
Accessions: BC018625
Gene id: 4507
Gene description: methylthioadenosine phosphorylase
Synonyms: BDMF; DMSFH; DMSMFH; HEL-249; LGMBF; MSAP; c86fus; S-methyl-5'-thioadenosine phosphorylase; 5'-methylthioadenosine phosphorylase; MTA phosphorylase; MTAPase; MeSAdo phosphorylase; epididymis luminal protein 249; methylthioadenosine phosphorylase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctctggcaccaccaccaccgccgtgaagattggaataattggtggaacaggcctggatgatccagaaattttagaaggaagaactgaaaaatatgtggatactccatttggcaagccatctgatgccttaattttggggaagataaaaaatgttgattgcatcctccttgcaaggcatggaaggcagcacaccatcatgccttcaaaggtcaactaccaggcgaacatctgggctttgaaggaagagggctgtacacatgtcatagtgaccacagcttgtggctccttgagggaggagattcagcccggcgatattgtcattattgatcagttcattgacagccatgtaagacgtgcctgcttccccttcaccttccatcatgattgtttccagagacctccccagaagccaagcagaagccactgtgtttcctgtgcaacctgcagaaccatgagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: