MTAP-methylthioadenosine phosphorylase Gene View larger

MTAP-methylthioadenosine phosphorylase Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MTAP-methylthioadenosine phosphorylase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MTAP-methylthioadenosine phosphorylase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018625
Product type: DNA & cDNA
Ncbi symbol: MTAP
Origin species: Human
Product name: MTAP-methylthioadenosine phosphorylase Gene
Size: 2ug
Accessions: BC018625
Gene id: 4507
Gene description: methylthioadenosine phosphorylase
Synonyms: BDMF; DMSFH; DMSMFH; HEL-249; LGMBF; MSAP; c86fus; S-methyl-5'-thioadenosine phosphorylase; 5'-methylthioadenosine phosphorylase; MTA phosphorylase; MTAPase; MeSAdo phosphorylase; epididymis luminal protein 249; methylthioadenosine phosphorylase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctctggcaccaccaccaccgccgtgaagattggaataattggtggaacaggcctggatgatccagaaattttagaaggaagaactgaaaaatatgtggatactccatttggcaagccatctgatgccttaattttggggaagataaaaaatgttgattgcatcctccttgcaaggcatggaaggcagcacaccatcatgccttcaaaggtcaactaccaggcgaacatctgggctttgaaggaagagggctgtacacatgtcatagtgaccacagcttgtggctccttgagggaggagattcagcccggcgatattgtcattattgatcagttcattgacagccatgtaagacgtgcctgcttccccttcaccttccatcatgattgtttccagagacctccccagaagccaagcagaagccactgtgtttcctgtgcaacctgcagaaccatgagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SEC11 homolog A (S. cerevisiae)
- hypothetical protein MGC29506
- ras homolog gene family, member H
- dual specificity phosphatase 13

Buy MTAP-methylthioadenosine phosphorylase Gene now

Add to cart