Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MTAP-methylthioadenosine phosphorylase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MTAP-methylthioadenosine phosphorylase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018625 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MTAP |
| Origin species: | Human |
| Product name: | MTAP-methylthioadenosine phosphorylase Gene |
| Size: | 2ug |
| Accessions: | BC018625 |
| Gene id: | 4507 |
| Gene description: | methylthioadenosine phosphorylase |
| Synonyms: | BDMF; DMSFH; DMSMFH; HEL-249; LGMBF; MSAP; c86fus; S-methyl-5'-thioadenosine phosphorylase; 5'-methylthioadenosine phosphorylase; MTA phosphorylase; MTAPase; MeSAdo phosphorylase; epididymis luminal protein 249; methylthioadenosine phosphorylase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctctggcaccaccaccaccgccgtgaagattggaataattggtggaacaggcctggatgatccagaaattttagaaggaagaactgaaaaatatgtggatactccatttggcaagccatctgatgccttaattttggggaagataaaaaatgttgattgcatcctccttgcaaggcatggaaggcagcacaccatcatgccttcaaaggtcaactaccaggcgaacatctgggctttgaaggaagagggctgtacacatgtcatagtgaccacagcttgtggctccttgagggaggagattcagcccggcgatattgtcattattgatcagttcattgacagccatgtaagacgtgcctgcttccccttcaccttccatcatgattgtttccagagacctccccagaagccaagcagaagccactgtgtttcctgtgcaacctgcagaaccatgagctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SEC11 homolog A (S. cerevisiae) - hypothetical protein MGC29506 - ras homolog gene family, member H - dual specificity phosphatase 13 |