Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SEC11A-SEC11 homolog A (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SEC11A-SEC11 homolog A (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014508 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SEC11A |
| Origin species: | Human |
| Product name: | SEC11A-SEC11 homolog A (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC014508 |
| Gene id: | 23478 |
| Gene description: | SEC11 homolog A (S. cerevisiae) |
| Synonyms: | signal peptidase complex catalytic subunit SEC11A; 1810012E07Rik; SEC11L1; SPC18; SPCS4A; sid2895; SEC11 homolog A; SEC11-like protein 1; SPase 18 kDa subunit; endopeptidase SP18; microsomal signal peptidase 18 kDa subunit; signal peptidase complex (18kD); signal peptidase complex 18; SEC11 homolog A, signal peptidase complex subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgtctctagactttttggacgatgtgcggcggatgaacaagcggcagctctattatcaagtcctaaattttggaatgattgtctcatcggcactaatgatctggaaggggttaatggtaataactggaagtgaaagtccgattgtagtggtgctcagtggcagcatggaacctgcatttcatagaggagatcttctctttctaacaaatcgagttgaagatcccatacgagtgggagaaattgttgtttttaggatagaaggaagagagattcctatagttcaccgagtcttgaagattcatgaaaagcaaaatgggcatatcaagtttttgaccaaaggagataataatgcggttgatgaccgaggcctctataaacaaggacaacattggctagagaaaaaagatgttgtggggagagccaggggatttgttccttatattggaattgtgacgatcctcatgaatgactatcctaaatttaagtatgcagttctctttttgctgggtttattcgtgctggttcatcgtgagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein MGC29506 - ras homolog gene family, member H - dual specificity phosphatase 13 - activating transcription factor 6 |