CXCL3-chemokine (C-X-C motif) ligand 3 Gene View larger

CXCL3-chemokine (C-X-C motif) ligand 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXCL3-chemokine (C-X-C motif) ligand 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CXCL3-chemokine (C-X-C motif) ligand 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016308
Product type: DNA & cDNA
Ncbi symbol: CXCL3
Origin species: Human
Product name: CXCL3-chemokine (C-X-C motif) ligand 3 Gene
Size: 2ug
Accessions: BC016308
Gene id: 2921
Gene description: chemokine (C-X-C motif) ligand 3
Synonyms: CINC-2b; GRO3; GROg; MIP-2b; MIP2B; SCYB3; C-X-C motif chemokine 3; GRO-gamma; GRO-gamma(1-73); GRO3 oncogene; MGSA gamma; MIP2-beta; chemokine (C-X-C motif) ligand 3; growth-regulated protein gamma; macrophage inflammatory protein 2-beta; melanoma growth stimulatory activity gamma; C-X-C motif chemokine ligand 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccacgccacgctctccgccgcccccagcaatccccggctcctgcgggtggcgctgctgctcctgctcctggtggccgccagccggcgcgcagcaggagcgtccgtggtcactgaactgcgctgccagtgcttgcagacactgcagggaattcacctcaagaacatccaaagtgtgaatgtaaggtcccccggaccccactgcgcccaaaccgaagtcatagccacactcaagaatgggaagaaagcttgtctcaaccccgcatcccccatggttcagaaaatcatcgaaaagatactgaacaaggggagcaccaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein MGC16291
- hypothetical protein MGC14425
- methylthioadenosine phosphorylase
- SEC11 homolog A (S. cerevisiae)

Buy CXCL3-chemokine (C-X-C motif) ligand 3 Gene now

Add to cart