Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CXCL3-chemokine (C-X-C motif) ligand 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CXCL3-chemokine (C-X-C motif) ligand 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016308 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CXCL3 |
| Origin species: | Human |
| Product name: | CXCL3-chemokine (C-X-C motif) ligand 3 Gene |
| Size: | 2ug |
| Accessions: | BC016308 |
| Gene id: | 2921 |
| Gene description: | chemokine (C-X-C motif) ligand 3 |
| Synonyms: | CINC-2b; GRO3; GROg; MIP-2b; MIP2B; SCYB3; C-X-C motif chemokine 3; GRO-gamma; GRO-gamma(1-73); GRO3 oncogene; MGSA gamma; MIP2-beta; chemokine (C-X-C motif) ligand 3; growth-regulated protein gamma; macrophage inflammatory protein 2-beta; melanoma growth stimulatory activity gamma; C-X-C motif chemokine ligand 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccacgccacgctctccgccgcccccagcaatccccggctcctgcgggtggcgctgctgctcctgctcctggtggccgccagccggcgcgcagcaggagcgtccgtggtcactgaactgcgctgccagtgcttgcagacactgcagggaattcacctcaagaacatccaaagtgtgaatgtaaggtcccccggaccccactgcgcccaaaccgaagtcatagccacactcaagaatgggaagaaagcttgtctcaaccccgcatcccccatggttcagaaaatcatcgaaaagatactgaacaaggggagcaccaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein MGC16291 - hypothetical protein MGC14425 - methylthioadenosine phosphorylase - SEC11 homolog A (S. cerevisiae) |