STAU2-staufen, RNA binding protein, homolog 2 (Drosophila) Gene View larger

STAU2-staufen, RNA binding protein, homolog 2 (Drosophila) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STAU2-staufen, RNA binding protein, homolog 2 (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about STAU2-staufen, RNA binding protein, homolog 2 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008370
Product type: DNA & cDNA
Ncbi symbol: STAU2
Origin species: Human
Product name: STAU2-staufen, RNA binding protein, homolog 2 (Drosophila) Gene
Size: 2ug
Accessions: BC008370
Gene id: 27067
Gene description: staufen, RNA binding protein, homolog 2 (Drosophila)
Synonyms: 39K2; 39K3; double-stranded RNA-binding protein Staufen homolog 2; staufen homolog 2; staufen, RNA binding protein, homolog 2; staufen double-stranded RNA binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttcaaataaatcagatgttctcagtgcagctgagtcttggtgagcagacatgggaatccgaaggcagcagtataaagaaggctcagcaggctgttgccaataaagctttgactgaatctacgcttcccaaaccagttcagaagccacccaaaagtaatgttaacaataacccaggcagtataactccaactgtggaactgaatgggcttgctatgaaaaggggagagcctgccatctacaggccattagatccaaagccattcccaaattatagagctaattacaactttcggggcatgtacaatcagagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SH3 domain binding glutamic acid-rich protein like
- ChaC, cation transport regulator homolog 2 (E. coli)
- cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
- N-acylsphingosine amidohydrolase (acid ceramidase) 1

Buy STAU2-staufen, RNA binding protein, homolog 2 (Drosophila) Gene now

Add to cart