Login to display prices
Login to display prices
AIF1L-allograft inflammatory factor 1-like Gene View larger

AIF1L-allograft inflammatory factor 1-like Gene

PTXBC021253

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AIF1L-allograft inflammatory factor 1-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AIF1L-allograft inflammatory factor 1-like Gene

Proteogenix catalog: PTXBC021253
Ncbi symbol: AIF1L
Product name: AIF1L-allograft inflammatory factor 1-like Gene
Size: 2ug
Accessions: BC021253
Gene id: 83543
Gene description: allograft inflammatory factor 1-like
Synonyms: 2810003C17Rik; AI043124; C87647; Iba2; allograft inflammatory factor 1-like; ionized calcium binding adapter molecule 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgggcgagctcagcaacaggttccaaggagggaaggcgttcggcttgctcaaagcccggcaggagaggaggctggccgagatcaaccgggagtttctgtgtgaccagaagtacagtgatgaagagaaccttccagaaaagctcacagccttcaaagagaagtacatggagtttgacctgaacaatgaaggcgagattgacctgatgtctttaaagaggatgatggagaagcttggtgtccccaagacccacctggagatgaagaagatgatctcagaggtgacaggagggagtcatgatgtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: