AIF1L-allograft inflammatory factor 1-like Gene View larger

AIF1L-allograft inflammatory factor 1-like Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AIF1L-allograft inflammatory factor 1-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AIF1L-allograft inflammatory factor 1-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021253
Product type: DNA & cDNA
Ncbi symbol: AIF1L
Origin species: Human
Product name: AIF1L-allograft inflammatory factor 1-like Gene
Size: 2ug
Accessions: BC021253
Gene id: 83543
Gene description: allograft inflammatory factor 1-like
Synonyms: 2810003C17Rik; AI043124; C87647; Iba2; allograft inflammatory factor 1-like; ionized calcium binding adapter molecule 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgggcgagctcagcaacaggttccaaggagggaaggcgttcggcttgctcaaagcccggcaggagaggaggctggccgagatcaaccgggagtttctgtgtgaccagaagtacagtgatgaagagaaccttccagaaaagctcacagccttcaaagagaagtacatggagtttgacctgaacaatgaaggcgagattgacctgatgtctttaaagaggatgatggagaagcttggtgtccccaagacccacctggagatgaagaagatgatctcagaggtgacaggagggagtcatgatgtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S36
- mitochondrial ribosomal protein L53
- chromosome 2 open reading frame 15
- chromosome 9 open reading frame 11

Buy AIF1L-allograft inflammatory factor 1-like Gene now

Add to cart