Login to display prices
Login to display prices
C2orf15-chromosome 2 open reading frame 15 Gene View larger

C2orf15-chromosome 2 open reading frame 15 Gene

PTXBC021264

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf15-chromosome 2 open reading frame 15 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf15-chromosome 2 open reading frame 15 Gene

Proteogenix catalog: PTXBC021264
Ncbi symbol: C2orf15
Product name: C2orf15-chromosome 2 open reading frame 15 Gene
Size: 2ug
Accessions: BC021264
Gene id: 150590
Gene description: chromosome 2 open reading frame 15
Synonyms: uncharacterized protein C2orf15; chromosome 2 open reading frame 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctcaactctggggaagttaagtaatcaagttgaagaaacacttccactacttaaaaaggtacctgcaaattactttcacatttgttcagctatcctaatgggattttcacttagtaaatctgctactcaggtatctgctatacatatggattcaaaagtggatgatcacttaatacgagggactgaaaaaagcaggttggaaccagcgactcagttatttcaaaacaccaagaaaataagattagaagacacaaatcaagaaaactttacaaggattgaagggactggcacaggatctctttctgggaaagccttgggttcagtggtatatgtcaaagaaagtgatggactagaaatgacagatgtggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: