C2orf15-chromosome 2 open reading frame 15 Gene View larger

C2orf15-chromosome 2 open reading frame 15 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf15-chromosome 2 open reading frame 15 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf15-chromosome 2 open reading frame 15 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021264
Product type: DNA & cDNA
Ncbi symbol: C2orf15
Origin species: Human
Product name: C2orf15-chromosome 2 open reading frame 15 Gene
Size: 2ug
Accessions: BC021264
Gene id: 150590
Gene description: chromosome 2 open reading frame 15
Synonyms: uncharacterized protein C2orf15; chromosome 2 open reading frame 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctcaactctggggaagttaagtaatcaagttgaagaaacacttccactacttaaaaaggtacctgcaaattactttcacatttgttcagctatcctaatgggattttcacttagtaaatctgctactcaggtatctgctatacatatggattcaaaagtggatgatcacttaatacgagggactgaaaaaagcaggttggaaccagcgactcagttatttcaaaacaccaagaaaataagattagaagacacaaatcaagaaaactttacaaggattgaagggactggcacaggatctctttctgggaaagccttgggttcagtggtatatgtcaaagaaagtgatggactagaaatgacagatgtggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 11
- mitochondrial ribosomal protein S14
- mitochondrial ribosomal protein L20
- chromosome 8 open reading frame 44

Buy C2orf15-chromosome 2 open reading frame 15 Gene now

Add to cart