C9orf11-chromosome 9 open reading frame 11 Gene View larger

C9orf11-chromosome 9 open reading frame 11 Gene

PTXBC014307

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf11-chromosome 9 open reading frame 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf11-chromosome 9 open reading frame 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014307
Product type: DNA & cDNA
Ncbi symbol: C9orf11
Origin species: Human
Product name: C9orf11-chromosome 9 open reading frame 11 Gene
Size: 2ug
Accessions: BC014307
Gene id: 54586
Gene description: chromosome 9 open reading frame 11
Synonyms: C9orf11; SPACA8; equatorin; Acrosome formation associated factor; acrosome formation-associated factor; equatorin, sperm acrosome associated; sperm acrosome associated 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaattttatattgtttatttttatacctggagttttttccttaaaaagtagcactttgaagcctactattgaagcattgcctaatgtgctacctttaaatgaagacgttaataagcaggaagaaaagaatgaagatcatactcccaattatgctcctgctaatgagaaaaatggcaattattataaagatataaaacaatatgtgttcacaacacaaaatccaaatggcactgagtctgaaatatctgtgagagccacaactgacctgaattttgctctaaaaaacgataaaactgtcaatgcaactacatatgaaaaatccaccattgaagaagaaacaactactagcgaaccctctcataaaaatattcaaagtatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S14
- mitochondrial ribosomal protein L20
- chromosome 8 open reading frame 44
- mitochondrial ribosomal protein S24

Buy C9orf11-chromosome 9 open reading frame 11 Gene now

Add to cart