MRPS24-mitochondrial ribosomal protein S24 Gene View larger

MRPS24-mitochondrial ribosomal protein S24 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS24-mitochondrial ribosomal protein S24 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS24-mitochondrial ribosomal protein S24 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012167
Product type: DNA & cDNA
Ncbi symbol: MRPS24
Origin species: Human
Product name: MRPS24-mitochondrial ribosomal protein S24 Gene
Size: 2ug
Accessions: BC012167
Gene id: 64951
Gene description: mitochondrial ribosomal protein S24
Synonyms: HSPC335; MRP-S24; S24mt; bMRP-47; bMRP47; 28S ribosomal protein S24, mitochondrial; mitochondrial 28S ribosomal protein S24; mitochondrial ribosomal protein S24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcctccgtgtgcagcgggttgctggggccacgggtgctgtcctggagccgagagctgccttgcgcttggcgcgccctgcacacctccccggtctgcgccaagaaccgggcggcccgagtacgcgtaagcaagggggacaagccggtgacctacgaggaggcacacgcgccgcactacatcgcccaccgtaaaggctggctgtcgctgcacacaggtaacctggatggagaggaccatgccgcagagcgaacggtggaggatgttttccttcgcaagttcatgtggggtaccttcccaggctgcctggctgaccagctggttttaaagcgccggggtaaccagttggagatctgtgccgtggtcctgaggcagttgtctccacacaagtactacttcctcgtgggctacagtgaaactttgctgtcctacttttacaaatgtcctgtgcgactccacctccaaactgtgccctcaaaggttgtgtataagtacctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger CCCH-type containing 7A
- chromosome 2 open reading frame 28
- golgi SNAP receptor complex member 1
- chromosome 7 open reading frame 33

Buy MRPS24-mitochondrial ribosomal protein S24 Gene now

Add to cart