Login to display prices
Login to display prices
MRPS24-mitochondrial ribosomal protein S24 Gene View larger

MRPS24-mitochondrial ribosomal protein S24 Gene

PTXBC012167

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS24-mitochondrial ribosomal protein S24 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS24-mitochondrial ribosomal protein S24 Gene

Proteogenix catalog: PTXBC012167
Ncbi symbol: MRPS24
Product name: MRPS24-mitochondrial ribosomal protein S24 Gene
Size: 2ug
Accessions: BC012167
Gene id: 64951
Gene description: mitochondrial ribosomal protein S24
Synonyms: HSPC335; MRP-S24; S24mt; bMRP-47; bMRP47; 28S ribosomal protein S24, mitochondrial; mitochondrial 28S ribosomal protein S24; mitochondrial ribosomal protein S24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcctccgtgtgcagcgggttgctggggccacgggtgctgtcctggagccgagagctgccttgcgcttggcgcgccctgcacacctccccggtctgcgccaagaaccgggcggcccgagtacgcgtaagcaagggggacaagccggtgacctacgaggaggcacacgcgccgcactacatcgcccaccgtaaaggctggctgtcgctgcacacaggtaacctggatggagaggaccatgccgcagagcgaacggtggaggatgttttccttcgcaagttcatgtggggtaccttcccaggctgcctggctgaccagctggttttaaagcgccggggtaaccagttggagatctgtgccgtggtcctgaggcagttgtctccacacaagtactacttcctcgtgggctacagtgaaactttgctgtcctacttttacaaatgtcctgtgcgactccacctccaaactgtgccctcaaaggttgtgtataagtacctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: