C2orf28-chromosome 2 open reading frame 28 Gene View larger

C2orf28-chromosome 2 open reading frame 28 Gene

PTXBC002846

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf28-chromosome 2 open reading frame 28 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf28-chromosome 2 open reading frame 28 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002846
Product type: DNA & cDNA
Ncbi symbol: C2orf28
Origin species: Human
Product name: C2orf28-chromosome 2 open reading frame 28 Gene
Size: 2ug
Accessions: BC002846
Gene id: 51374
Gene description: chromosome 2 open reading frame 28
Synonyms: C2orf28; APR--3; APR-3; APR3; HSPC013; PRO240; p18; all-trans retinoic acid-induced differentiation factor; apoptosis related protein APR-3; apoptosis-related protein 3; all-trans retinoic acid induced differentiation factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcatgcccgttgctgcctgaatcagaagggcaccatcttggggctggatctccagaactgttctctggaggaccctggtccaaactttcatcaggcacataccactgtcatcatagacctgcaagcaaaccccctcaaaggtgacttggccaacaccttccgtggctttactcagctccagactctgatactgccacaacatgtcaactgtcctggaggaattaatgcctggaatactatcacctcttatatagacaaccaaatctgtcaagggcaaaagaacctttgcaataacactggggacccagaaatgtgtcctgagaatggatcttgtgtacctgatggtccaggtcttttgcagtgtgtttgtgctgatggtttccatggatacaagtgtatgcgccagggctcgttctcactgcttatgttcttcgggattctgggagccaccactctatccgtctccattctgctttgggcgacccagcgccgaaaagccaagacttcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - golgi SNAP receptor complex member 1
- chromosome 7 open reading frame 33
- mitochondrial ribosomal protein L18
- RAP2B, member of RAS oncogene family

Buy C2orf28-chromosome 2 open reading frame 28 Gene now

Add to cart