MRPL18-mitochondrial ribosomal protein L18 Gene View larger

MRPL18-mitochondrial ribosomal protein L18 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL18-mitochondrial ribosomal protein L18 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL18-mitochondrial ribosomal protein L18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001623
Product type: DNA & cDNA
Ncbi symbol: MRPL18
Origin species: Human
Product name: MRPL18-mitochondrial ribosomal protein L18 Gene
Size: 2ug
Accessions: BC001623
Gene id: 29074
Gene description: mitochondrial ribosomal protein L18
Synonyms: HSPC071; L18mt; MRP-L18; 39S ribosomal protein L18, mitochondrial; mitochondrial ribosomal protein L18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcttcggtcgcggttttgggggttgttctcggtttgcaggaaccctgggtgcaggttcgcagccctgtcaaccagctccgagccggcagcgaaacctgaagtggaccctgtggaaaatgaagctgtcgccccagaattcaccaaccggaacccccggaacctggagcttttatctgtagccaggaaagagcggggctggcggacggtgtttccctcccgtgagttctggcacaggttgcgagttataaggactcagcatcatgtagaagcacttgtggagcatcagaatggcaaggttgtggtttcggcctccactcgtgagtgggctattaaaaagcacctttatagtaccagaaatgtggtggcttgtgagagtataggacgagtgctggcacagagatgcttagaggcgggaatcaacttcatggtctaccaaccaaccccgtgggaggcagcctcagactcgatgaaacgactacaaagtgccatgacagaaggtggtgtggttctacgggaacctcagagaatctatgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAP2B, member of RAS oncogene family
- RAP1A, member of RAS oncogene family
- mitochondrial ribosomal protein S23
- torsin family 1, member A (torsin A)

Buy MRPL18-mitochondrial ribosomal protein L18 Gene now

Add to cart