Login to display prices
Login to display prices
RAP1A-RAP1A, member of RAS oncogene family Gene View larger

RAP1A-RAP1A, member of RAS oncogene family Gene

PTXBC014086

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAP1A-RAP1A, member of RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAP1A-RAP1A, member of RAS oncogene family Gene

Proteogenix catalog: PTXBC014086
Ncbi symbol: RAP1A
Product name: RAP1A-RAP1A, member of RAS oncogene family Gene
Size: 2ug
Accessions: BC014086
Gene id: 5906
Gene description: RAP1A, member of RAS oncogene family
Synonyms: RAP1A, member of RAS oncogene family; C21KG; G-22K; KREV-1; KREV1; SMGP21; ras-related protein Rap-1A; GTP-binding protein smg p21A; Ras-related protein Krev-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgtgagtacaagctagtggtccttggttcaggaggcgttgggaagtctgctctgacagttcagtttgttcagggaatttttgttgaaaaatatgacccaacgatagaagattcctacagaaagcaagttgaagtcgattgccaacagtgtatgctcgaaatcctggatactgcagggacagagcaatttacagcaatgagggatttgtatatgaagaacggccaaggttttgcactagtatattctattacagctcagtccacgtttaacgacttacaggacctgagggaacagattttacgggttaaggacacggaagatgttccaatgattttggttggcaataaatgtgacctggaagatgagcgagtagttggcaaagagcagggccagaatttagcaagacagtggtgtaactgtgcctttttagaatcttctgcaaagtcaaagatcaatgttaatgagatattttatgacctggtcagacagataaataggaaaacaccagtggaaaagaagaagcctaaaaagaaatcatgtctgctgctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: