C8orf44-chromosome 8 open reading frame 44 Gene View larger

C8orf44-chromosome 8 open reading frame 44 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C8orf44-chromosome 8 open reading frame 44 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C8orf44-chromosome 8 open reading frame 44 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014448
Product type: DNA & cDNA
Ncbi symbol: C8orf44
Origin species: Human
Product name: C8orf44-chromosome 8 open reading frame 44 Gene
Size: 2ug
Accessions: BC014448
Gene id: 56260
Gene description: chromosome 8 open reading frame 44
Synonyms: chromosome 8 open reading frame 44
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggaagaatgagagttatctcaaccagccagcaccccctatccccattcccacactttccctcatgggaggctgtcgggagcacttcgaaaaccactggaaaggccgggcacggtggctcatgcctgtaatcccagcactttgggaggccaaggcaggcagatcacctgaggtcaggagttcgaaaccagcctggccaacatggcgaaaccccatctttactaaaaatacgaaaattagccaggtattagaattatttctgaattatcagtctctcatttgtgctttggagaagcagaaaaggcaaaaggggtctttggccatcttctgctggagcttccagggaggatgtgtctccaagagaccagatgtaccgagtttgaaatcccagaagcccaagaggaaaagaatcacagggaggaaaagactgtccaaaggctcctggagtcttctgttctctaaccttggaaggttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S24
- zinc finger CCCH-type containing 7A
- chromosome 2 open reading frame 28
- golgi SNAP receptor complex member 1

Buy C8orf44-chromosome 8 open reading frame 44 Gene now

Add to cart