MRPL53-mitochondrial ribosomal protein L53 Gene View larger

MRPL53-mitochondrial ribosomal protein L53 Gene

PTXBC012163

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL53-mitochondrial ribosomal protein L53 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL53-mitochondrial ribosomal protein L53 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012163
Product type: DNA & cDNA
Ncbi symbol: MRPL53
Origin species: Human
Product name: MRPL53-mitochondrial ribosomal protein L53 Gene
Size: 2ug
Accessions: BC012163
Gene id: 116540
Gene description: mitochondrial ribosomal protein L53
Synonyms: L53MT; 39S ribosomal protein L53, mitochondrial; mitochondrial ribosomal protein L53
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagctgccttggctcggcttggtctgcggcctgtcaaacaggttcgggttcagttctgtcccttcgagaaaaacgtggaatcgacgaggaccttcctgcagacggtgagcagtgagaaggtccgctccactaatctcaactgctcagtgattgcggacgtgaggcatgacggctccgagccctgcgtggacgtgctgttcggagacgggcatcgcctgattatgcgcggcgctcatctcaccgctctggaaatgctcaccgccttcgcctcccacatccgggccagggacgcggcgggcagcggggacaagccgggcgctgatactggtcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 2 open reading frame 15
- chromosome 9 open reading frame 11
- mitochondrial ribosomal protein S14
- mitochondrial ribosomal protein L20

Buy MRPL53-mitochondrial ribosomal protein L53 Gene now

Add to cart