MRPS36-mitochondrial ribosomal protein S36 Gene View larger

MRPS36-mitochondrial ribosomal protein S36 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS36-mitochondrial ribosomal protein S36 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS36-mitochondrial ribosomal protein S36 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015966
Product type: DNA & cDNA
Ncbi symbol: MRPS36
Origin species: Human
Product name: MRPS36-mitochondrial ribosomal protein S36 Gene
Size: 2ug
Accessions: BC015966
Gene id: 92259
Gene description: mitochondrial ribosomal protein S36
Synonyms: DC47; MRP-S36; 28S ribosomal protein S36, mitochondrial; S36mt; mitochondrial ribosomal protein S36
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgggcagcaagatggcgtctgctagtagggtcgttcaggtagtcaaaccacacactccattaataaggtttcctgacagaagagacaatcctaaacccaatgtatcagaagctttgagatcagcagggctaccatctcactcttctgtaatttcacaacattctaaaggaagtaaatcaccagatttgctgatgtatcagggtccaccagacactgcagaaataataaaaacattacctcagaaatacagaaggaaacttgtgtctcaagaagaaatggaatttatccaacgtggaggtcctgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L53
- chromosome 2 open reading frame 15
- chromosome 9 open reading frame 11
- mitochondrial ribosomal protein S14

Buy MRPS36-mitochondrial ribosomal protein S36 Gene now

Add to cart