Login to display prices
Login to display prices
EPAS1-endothelial PAS domain protein 1 Gene View larger

EPAS1-endothelial PAS domain protein 1 Gene

PTXBC015869

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EPAS1-endothelial PAS domain protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EPAS1-endothelial PAS domain protein 1 Gene

Proteogenix catalog: PTXBC015869
Ncbi symbol: EPAS1
Product name: EPAS1-endothelial PAS domain protein 1 Gene
Size: 2ug
Accessions: BC015869
Gene id: 2034
Gene description: endothelial PAS domain protein 1
Synonyms: ECYT4; HIF2A; HLF; MOP2; PASD2; bHLHe73; endothelial PAS domain-containing protein 1; EPAS-1; HIF-1-alpha-like factor; HIF-1alpha-like factor; HIF-2-alpha; HIF2-alpha; PAS domain-containing protein 2; basic-helix-loop-helix-PAS protein MOP2; class E basic helix-loop-helix protein 73; hypoxia-inducible factor 2 alpha; member of PAS protein 2; endothelial PAS domain protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtctttcacacggcacatttggacatttccagaactaccatgagatggtttagacgggaattcatgcaaatgaggggtcaaaaatggtatagtgaccccgtccacgtcctccaagctcacgaccttggagccccgtggagctggactgaggaggaggctgcacagcgggagagcagctggtccagaccagccctgcagcccccactcagccggcagccagatggccccgcaaggcctccagggatggcccctagccacaggccctggctgaggtctctgggtcggtcagtgacatgtaggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: