PHLDB1-pleckstrin homology-like domain, family B, member 1 Gene View larger

PHLDB1-pleckstrin homology-like domain, family B, member 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PHLDB1-pleckstrin homology-like domain, family B, member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PHLDB1-pleckstrin homology-like domain, family B, member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014510
Product type: DNA & cDNA
Ncbi symbol: PHLDB1
Origin species: Human
Product name: PHLDB1-pleckstrin homology-like domain, family B, member 1 Gene
Size: 2ug
Accessions: BC014510
Gene id: 23187
Gene description: pleckstrin homology-like domain, family B, member 1
Synonyms: pleckstrin homology-like domain family B member 1; LL5alpha; pleckstrin homology-like domain family B member 1 variant 3; pleckstrin homology-like domain family B member 1 variant 4; protein LL5-alpha; pleckstrin homology like domain family B member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcggcaagattaaatcatggaagaagcgctggtttgtcttcgaccggctcaagcgcaccctttcctattatgtggacaagcatgagacgaagctgaagggagtcatctatttccaggccattgaggaagtgtactacgaccacctgcgcagtgcagccaagagcccgaacccagccctcaccttctgcgtaaagacccatgaccggctgtactacatggtggccccatctgcagaggccatgcgtatctggatggatgtcattgtcacaggggctgagggctacactcagttcatgaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - staufen, RNA binding protein, homolog 2 (Drosophila)
- SH3 domain binding glutamic acid-rich protein like
- ChaC, cation transport regulator homolog 2 (E. coli)
- cytidine monophosphate (UMP-CMP) kinase 1, cytosolic

Buy PHLDB1-pleckstrin homology-like domain, family B, member 1 Gene now

Add to cart