Login to display prices
Login to display prices
S100A4-S100 calcium binding protein A4 Gene View larger

S100A4-S100 calcium binding protein A4 Gene

PTXBC016300

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A4-S100 calcium binding protein A4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100A4-S100 calcium binding protein A4 Gene

Proteogenix catalog: PTXBC016300
Ncbi symbol: S100A4
Product name: S100A4-S100 calcium binding protein A4 Gene
Size: 2ug
Accessions: BC016300
Gene id: 6275
Gene description: S100 calcium binding protein A4
Synonyms: 18A2; 42A; CAPL; FSP1; MTS1; P9KA; PEL98; protein S100-A4; S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog); fibroblast-specific protein-1; leukemia multidrug resistance associated protein; malignant transformation suppression 1; placental calcium-binding protein; protein Mts1; S100 calcium binding protein A4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtgccctctggagaaggccctggatgtgatggtgtccaccttccacaagtactcgggcaaagagggtgacaagttcaagctcaacaagtcagaactaaaggagctgctgacccgggagctgcccagcttcttggggaaaaggacagatgaagctgctttccagaagctgatgagcaacttggacagcaacagggacaacgaggtggacttccaagagtactgtgtcttcctgtcctgcatcgccatgatgtgtaacgaattctttgaaggcttcccagataagcagcccaggaagaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: