Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of S100A4-S100 calcium binding protein A4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about S100A4-S100 calcium binding protein A4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016300 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | S100A4 |
| Origin species: | Human |
| Product name: | S100A4-S100 calcium binding protein A4 Gene |
| Size: | 2ug |
| Accessions: | BC016300 |
| Gene id: | 6275 |
| Gene description: | S100 calcium binding protein A4 |
| Synonyms: | 18A2; 42A; CAPL; FSP1; MTS1; P9KA; PEL98; protein S100-A4; S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog); fibroblast-specific protein-1; leukemia multidrug resistance associated protein; malignant transformation suppression 1; placental calcium-binding protein; protein Mts1; S100 calcium binding protein A4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtgccctctggagaaggccctggatgtgatggtgtccaccttccacaagtactcgggcaaagagggtgacaagttcaagctcaacaagtcagaactaaaggagctgctgacccgggagctgcccagcttcttggggaaaaggacagatgaagctgctttccagaagctgatgagcaacttggacagcaacagggacaacgaggtggacttccaagagtactgtgtcttcctgtcctgcatcgccatgatgtgtaacgaattctttgaaggcttcccagataagcagcccaggaagaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - endothelial PAS domain protein 1 - chemokine (C-X-C motif) ligand 3 - hypothetical protein MGC16291 - hypothetical protein MGC14425 |