C8orf40-chromosome 8 open reading frame 40 Gene View larger

C8orf40-chromosome 8 open reading frame 40 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C8orf40-chromosome 8 open reading frame 40 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C8orf40-chromosome 8 open reading frame 40 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013035
Product type: DNA & cDNA
Ncbi symbol: C8orf40
Origin species: Human
Product name: C8orf40-chromosome 8 open reading frame 40 Gene
Size: 2ug
Accessions: BC013035
Gene id: 114926
Gene description: chromosome 8 open reading frame 40
Synonyms: UPF0697 protein C8orf40; C8orf40; small integral membrane protein 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtgacgatggttctattgattatactgttcacgaagcctggaatgaagccaccaatgtttacttgatagttatccttgttagcttcggtctcttcatgtatgccaaaaggaacaaaaggagaattatgaggatattcagtgtgccacctacagaggaaactttgtcagagcccaacttttatgacacgataagcaagattcgtttaagacaacaactggaaatgtattccatttcaagaaagtacgactatcagcagccacaaaaccaagctgacagtgtgcaactctcattggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - allograft inflammatory factor 1-like
- mitochondrial ribosomal protein S36
- mitochondrial ribosomal protein L53
- chromosome 2 open reading frame 15

Buy C8orf40-chromosome 8 open reading frame 40 Gene now

Add to cart