DPY30-dpy-30 homolog (C. elegans) Gene View larger

DPY30-dpy-30 homolog (C. elegans) Gene

PTXBC015970

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DPY30-dpy-30 homolog (C. elegans) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DPY30-dpy-30 homolog (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015970
Product type: DNA & cDNA
Ncbi symbol: DPY30
Origin species: Human
Product name: DPY30-dpy-30 homolog (C. elegans) Gene
Size: 2ug
Accessions: BC015970
Gene id: 84661
Gene description: dpy-30 homolog (C. elegans)
Synonyms: Cps25; HDPY-30; Saf19; protein dpy-30 homolog; dpy-30 homolog; dpy-30-like protein; dpy-30L; dpy-30, histone methyltransferase complex regulatory subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccagagcagatgctggagggacaaacgcaggttgcagaaaatcctcactctgagtacggtctcacagacaacgttgagagaatagtagaaaatgagaagattaatgcagaaaagtcatcaaagcagaaggtagatctccagtctttgccaactcgtgcctacctggatcagacagttgtgcctatcttattacagggacttgctgtgcttgcaaaggaaagaccaccaaatcccattgaatttctagcatcttatcttttaaaaaacaaggcacagtttgaagatcgaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 100
- transmembrane protein 203
- enabled homolog (Drosophila)
- translocator protein (18kDa)

Buy DPY30-dpy-30 homolog (C. elegans) Gene now

Add to cart