Cart 4 Product Products 467,28 € (empty)
-
1 x SIAH1-seve...121,50 € -
1 x CCDC97-coi...121,50 € -
1 x BCAT2-bran...121,50 € -
No products
To be determined Shipping
467,28 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 467,28 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 467,28 €
Data sheet of ENAH-enabled homolog (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ENAH-enabled homolog (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010414 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ENAH |
| Origin species: | Human |
| Product name: | ENAH-enabled homolog (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC010414 |
| Gene id: | 55740 |
| Gene description: | enabled homolog (Drosophila) |
| Synonyms: | ENA; MENA; NDPP1; protein enabled homolog; mammalian enabled variant 11a; mammalian enabled variant pan; enabled homolog (Drosophila) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaattcaaagaagacaactacaagaacagcaacggcaaaaggagctggagcgggaaaggctggagcgagaaagaatggaaagagaaaggttggagagagagaggttagaaagggaaaggctggagagggagcgactggaacaagaacagctggagagagagagacaagaacgggaacggcaggaacgcctggagcggcaggaacgcctggagcggcaggaacgcctggatcgggagaggcaagaaagacaagaacgagagaggctggagagactggaacgggagaggcaagaaagggagcgacaagagcagttagaaagggaacagctggaatgggagagagagcgcagaatatcaagtgctggtaagaagtttacaaactcttctgtgttcttgtatctgagcttggatgatgtctcttgtgcagtcatgtgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translocator protein (18kDa) - transmembrane protein 208 - mediator complex subunit 28 - transmembrane protein 222 |