Cart 1 Product Products 113,40 € (empty)
-
1 x CGB-chorio...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of TSPO-translocator protein (18kDa) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TSPO-translocator protein (18kDa) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001110 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TSPO |
| Origin species: | Human |
| Product name: | TSPO-translocator protein (18kDa) Gene |
| Size: | 2ug |
| Accessions: | BC001110 |
| Gene id: | 706 |
| Gene description: | translocator protein (18kDa) |
| Synonyms: | BPBS; BZRP; DBI; IBP; MBR; PBR; PBS; PKBS; PTBR; mDRC; pk18; translocator protein; benzodiazepine peripheral binding site; mitochondrial benzodiazepine receptor; peripheral-type benzodiazepine receptor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccccgccctgggtgcccgccatgggcttcacgctggcgcccagcctggggtgcttcgtgggctcccgctttgtccacggcgagggtctccgctggtacgccggcctgcagaagccctcgtggcacccgccccactgggtgctgggccctgtctggggcacgctctactcagccatggggtacggctcctacctggtctggaaagagctgggaggcttcacagagaaggctgtggttcccctgggcctctacactgggcagctggccctgaactgggcatggccccccatcttctttggtgcccgacaaatgggctgggccttggtggatctcctgctggtcagtggggcggcggcagccactaccgtggcctggtaccaggtgagcccgctggccgcccgcctgctctacccctacctggcctggctggccttcgcgaccacactcaactactgcgtatggcgggacaaccatggctggcatgggggacggcggctgccagagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 208 - mediator complex subunit 28 - transmembrane protein 222 - SERTA domain containing 3 |