TSPO-translocator protein (18kDa) Gene View larger

TSPO-translocator protein (18kDa) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSPO-translocator protein (18kDa) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSPO-translocator protein (18kDa) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001110
Product type: DNA & cDNA
Ncbi symbol: TSPO
Origin species: Human
Product name: TSPO-translocator protein (18kDa) Gene
Size: 2ug
Accessions: BC001110
Gene id: 706
Gene description: translocator protein (18kDa)
Synonyms: BPBS; BZRP; DBI; IBP; MBR; PBR; PBS; PKBS; PTBR; mDRC; pk18; translocator protein; benzodiazepine peripheral binding site; mitochondrial benzodiazepine receptor; peripheral-type benzodiazepine receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccccgccctgggtgcccgccatgggcttcacgctggcgcccagcctggggtgcttcgtgggctcccgctttgtccacggcgagggtctccgctggtacgccggcctgcagaagccctcgtggcacccgccccactgggtgctgggccctgtctggggcacgctctactcagccatggggtacggctcctacctggtctggaaagagctgggaggcttcacagagaaggctgtggttcccctgggcctctacactgggcagctggccctgaactgggcatggccccccatcttctttggtgcccgacaaatgggctgggccttggtggatctcctgctggtcagtggggcggcggcagccactaccgtggcctggtaccaggtgagcccgctggccgcccgcctgctctacccctacctggcctggctggccttcgcgaccacactcaactactgcgtatggcgggacaaccatggctggcatgggggacggcggctgccagagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 208
- mediator complex subunit 28
- transmembrane protein 222
- SERTA domain containing 3

Buy TSPO-translocator protein (18kDa) Gene now

Add to cart